UK Judges Think US Makes It Too Hard To Get Patents, Lower Patentability Bar To Show How It's Done
from the you-mean-we-need-even-more? dept
The US patent system famously covers "anything under the sun that is made by man," and is generally regarded as being more "patent friendly" than other jurisdictions around the world. So it comes as something of a surprise to hear of the UK out-doing the US is this respect:In a unanimous decision, the [UK Supreme] court determined that US utility doctrine creates an unduly high bar of patentability.The reasoning – or rather lack of it – is just as surprising:
Thus, rather than requiring proof of specific, credible, and substantial utility at the time of filing, the UK court agreed that HGS's genetic sequence coding for Neutrokine-α was patentable even though there was no known use of the protein at the time the patent application was filing. The patent did not reveal how the protein "could be used to solve any particular problem" nor did it identify "any disease or condition which it could be used to diagnose or treat."It's bad enough that naturally-occurring genomic sequences are being patented at all – sequences that certainly weren't invented by anyone. But allowing those patents without even requiring "proof of specific, credible, and substantial utility at the time of filing" is just insane: it will open the floodgates for even more speculative filings on DNA sequences in the hope that someone, someday will come up with a use for them. Except that if they did, they'd presumably be hit with a patent infringement suit. So how does that promote innovation?
The other danger, of course, is that the US judges might feel that their honor is a stake, and lower the US patentability bar even further to undercut those presumptuous British lords...
Follow me @glynmoody on Twitter or identi.ca, and on Google+
Thank you for reading this Techdirt post. With so many things competing for everyone’s attention these days, we really appreciate you giving us your time. We work hard every day to put quality content out there for our community.
Techdirt is one of the few remaining truly independent media outlets. We do not have a giant corporation behind us, and we rely heavily on our community to support us, in an age when advertisers are increasingly uninterested in sponsoring small, independent sites — especially a site like ours that is unwilling to pull punches in its reporting and analysis.
While other websites have resorted to paywalls, registration requirements, and increasingly annoying/intrusive advertising, we have always kept Techdirt open and available to anyone. But in order to continue doing so, we need your support. We offer a variety of ways for our readers to support us, from direct donations to special subscriptions and cool merchandise — and every little bit helps. Thank you.
–The Techdirt Team
Filed Under: gene patents, patents, uk, us
Reader Comments
Subscribe: RSS
View by: Time | Thread
[ link to this | view in chronology ]
Re:
particule filter, stream coherence filter?
I could think of a few nonsensical names for that LoL
[ link to this | view in chronology ]
Re:
1) Patent naturally occurring gene
2) Don't know what to use it for
3) ???
4) Sue all of humanity for using it
[ link to this | view in chronology ]
GCTGCTATATAGCGCGCTATAGCTTATATACACCGGGGG
CTCTATTAGATGCGCTGATATATATATCGCGCGTAGTCG
ATGAT TATCGCGCGAGTAAATATATAAATTATATAGCTA
TGCTAGCGGCGCCTATTACTGATATCTGGCGCCCTCTAT
TCGGCATATATATCGCGCGTAGT CGATGATTATCGCGCG
AGTAAATATATAAATTATATAGCTATGCTAGCGGCGCCT
© 2011 BentFranklin
[ link to this | view in chronology ]
Re:
You know how I can tell you're bold?
[ link to this | view in chronology ]
Re: Re:
[ link to this | view in chronology ]
Re:
[ link to this | view in chronology ]
[ link to this | view in chronology ]
Re:
[ link to this | view in chronology ]
Promoting Innovation is an American concept
Bad as it may be, our system is better. And it shows in the statistics. They should be learning from us, not the other way around.
[ link to this | view in chronology ]
Re: Promoting Innovation is an American concept
[ link to this | view in chronology ]
Re: Promoting Innovation is an American concept
[ link to this | view in chronology ]
[ link to this | view in chronology ]
I for one welcome the "pirates" who will become revolutionaries when they win the copyright battle and it is scaled back to a reasonable term.
[ link to this | view in chronology ]
[ link to this | view in chronology ]
[ link to this | view in chronology ]
Re:
[ link to this | view in chronology ]
Response to: Anonymous Coward on Nov 14th, 2011 @ 2:45pm
[ link to this | view in chronology ]
Re:
People keep getting patents for things already invented or discovered, that is no accident.
The patent system is just a big sham.
[ link to this | view in chronology ]
[ link to this | view in chronology ]
Re:
[ link to this | view in chronology ]
[ link to this | view in chronology ]
It's not engineered (although it can be), it's a naturally occurring resource like oil, trees, and fish.
The fact that you saw a species of fish or tree first doesn't mean you get a monopoly on it.
The first person who saw some oil didn't get a patent on all petroleum products.
It seems like a bad farce to me.
[ link to this | view in chronology ]
US v UK
[ link to this | view in chronology ]
Re: US v UK
[ link to this | view in chronology ]
another biased article
Inventors agree.
Masnick and his monkeys have an unreported conflict of interest-
https://www.insightcommunity.com/cases.php?n=10&pg=1
They sell blog filler and "insights" to major corporations including MS, HP, IBM etc. who just happen to be some of the world’s most frequent patent suit defendants. Obviously, he has failed to report his conflicts as any reputable reporter would. But then Masnick and his monkeys are not reporters. They are patent system saboteurs receiving funding from huge corporate infringers. They cannot be trusted and have no credibility. All they know about patents is they don’t have any.
"patent reform"
“This is not a patent reform bill” Senator Maria Cantwell (D-WA) complained, despite other democrats praising the overhaul. “This is a big corporation patent giveaway that tramples on the right of small inventors.”
Senator Cantwell is right. Just because they call it “reform” doesn’t mean it is. The agents of banks, huge multinationals, and China are at it again trying to brain wash and bankrupt America.
They should have called the bill the America STOPS Inventing Act or ASIA, because that’s where it is sending all our jobs.
The patent bill is nothing less than another monumental federal giveaway for banks, huge multinationals, and China and an off shoring job killing nightmare for America. Even the leading patent expert in China has stated the bill will help them steal our inventions. Who are the supporters of this bill working for??
Patent reform is a fraud on America. This bill will not do what they claim it will. What it will do is help large multinational corporations maintain their monopolies by robbing and killing their small entity and startup competitors (so it will do exactly what the large multinationals paid for) and with them the jobs they would have created. The bill will make it harder and more expensive for small firms to get and enforce their patents. Without patents we cant get funded. Yet small entities create the lion's share of new jobs. According to recent studies by the Kauffman Foundation and economists at the U.S. Census Bureau, “startups aren’t everything when it comes to job growth. They’re the only thing.” This bill is a wholesale slaughter of US jobs. Those wishing to help fight this bill should contact us as below.
Small entities and inventors have been given far too little voice on this bill when one considers that they rely far more heavily on the patent system than do large firms who can control their markets by their size alone. The smaller the firm, the more they rely on patents -especially startups and individual inventors. Congress tinkering with patent law while gagging inventors is like a surgeon operating before examining the patient.
Please see http://truereform.piausa.org/default.html for a different/opposing view on patent reform.
http://docs.piausa.org/
[ link to this | view in chronology ]